Invertendo DNA

Publicado por Eder S. G. 27/07/2003

[ Hits: 5.131 ]

Homepage: http://edersg.wordpress.com

Download genetica.pl




Script desenvolvido na linguagem PERL que inverte a ordem de um DNA.

  



Esconder código-fonte

#!/usr/bin/perl

# Autor   : Eder S. G.
# E-M@il  : edersg23@terra.com.br
# Site    : www.dartline.com.br/edersg23/
# Data    : 03/07/2003
# Versão  : 1.0
# Licença : GPL

# Sequência que se deseja utilizar:
$dna01 = 'TTCCGAGCCAATTGTATCAGTTGCCAATAG';

# Inverte a ordem da sequência de DNA acima:
$dna01_invertido = reverse $dna01;

# Troca as bases produzindo a fita complementar:
$dna01_invertido =~ tr/ACGTA/TGCA/;

# Exibe na tela o conteúdo da variável dna01_invertido:
print "A sequência invertida é : \n $dna01_invertido\n";

Scripts recomendados

Check All Process

MyBF - Interpretador de BrainFuck

MoOnCrack

Tirando screenshots facilmente !

Eterm sem bordas


  

Comentários
[1] Comentário enviado por taiar em 27/07/2003 - 23:32h

Olá , trabalhas com BIOINFORMÁTICA?


Contribuir com comentário




Patrocínio

Site hospedado pelo provedor RedeHost.
Linux banner
Linux banner
Linux banner

Destaques

Artigos

Dicas

Tópicos

Top 10 do mês

Scripts