Invertendo DNA

Publicado por Eder S. G. 27/07/2003

[ Hits: 5.428 ]

Homepage: http://edersg.wordpress.com

Download genetica.pl




Script desenvolvido na linguagem PERL que inverte a ordem de um DNA.

  



Esconder código-fonte

#!/usr/bin/perl

# Autor   : Eder S. G.
# [email protected]  : [email protected]
# Site    : www.dartline.com.br/edersg23/
# Data    : 03/07/2003
# Versão  : 1.0
# Licença : GPL

# Sequência que se deseja utilizar:
$dna01 = 'TTCCGAGCCAATTGTATCAGTTGCCAATAG';

# Inverte a ordem da sequência de DNA acima:
$dna01_invertido = reverse $dna01;

# Troca as bases produzindo a fita complementar:
$dna01_invertido =~ tr/ACGTA/TGCA/;

# Exibe na tela o conteúdo da variável dna01_invertido:
print "A sequência invertida é : \n $dna01_invertido\n";

Scripts recomendados

Beep-Media-Player for Torsmo

Role-Playing Script

Verificação se utilizador existe ou não

Audacious X-Chat Plugin

Wallpaper no Fluxbox


  

Comentários
[1] Comentário enviado por taiar em 27/07/2003 - 23:32h

Olá , trabalhas com BIOINFORMÁTICA?


Contribuir com comentário